Generated:Article Title: Spectrin coordinates cell shape and signaling essential for epidermal differentiation.
Article Snippet: 100 μl transfection mix was used per well with 1 ml FAD medium (12- well plate, 5 nM siRNA f.c.). siRNA (siPOOLs) against αIISpectrin were obtained from siPOOLs from siTOOLs. .. Lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; #10878; Addgene plasmid), lentivirus-GFP, or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; #25999; Addgene plasmid) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website (http://portals.broadinstitute.org/gpp/ public/resources/protocols). .. See also (Beronja et al., 2010; Soffer et al., 2022) for generation of lentiviruses. shRNA sequences were obtained from GPP (https://portals.broadinstitute.org/ gpp/public/): Sptan1(0595) construct #TRCN0000090595, target sequence 5′-GCCACCGATGAAGCTTATAAA-3′.
Article Title: Spectrin coordinates cortical actomyosin organization and differentiation essential for a functional epithelial barrier
Article Snippet: .. Briefly, lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; Addgene plasmid #10878), lentivirus-GFP or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; Addgene plasmid #25999) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5’- GCCACCGATGAAGCTTATAAA -3’. ..
Article Title: Spectrin coordinates cell shape and signaling essential for epidermal differentiation
Article Snippet: 100 μl transfection mix was used per well with 1 ml FAD medium (12-well plate, 5 nM siRNA f.c.). siRNA (siPOOLs) against αII-Spectrin were obtained from siPOOLs from siTOOLs. .. Lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; #10878; Addgene plasmid), lentivirus-GFP, or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; #25999; Addgene plasmid) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). .. See also ( ; ) for generation of lentiviruses. shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5′-GCC ACC GAT GAA GCT TAT AAA-3′.
Cloning:Article Title: Spectrin coordinates cell shape and signaling essential for epidermal differentiation.
Article Snippet: 100 μl transfection mix was used per well with 1 ml FAD medium (12- well plate, 5 nM siRNA f.c.). siRNA (siPOOLs) against αIISpectrin were obtained from siPOOLs from siTOOLs. .. Lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; #10878; Addgene plasmid), lentivirus-GFP, or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; #25999; Addgene plasmid) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website (http://portals.broadinstitute.org/gpp/ public/resources/protocols). .. See also (Beronja et al., 2010; Soffer et al., 2022) for generation of lentiviruses. shRNA sequences were obtained from GPP (https://portals.broadinstitute.org/ gpp/public/): Sptan1(0595) construct #TRCN0000090595, target sequence 5′-GCCACCGATGAAGCTTATAAA-3′.
Article Title: Spectrin coordinates cortical actomyosin organization and differentiation essential for a functional epithelial barrier
Article Snippet: .. Briefly, lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; Addgene plasmid #10878), lentivirus-GFP or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; Addgene plasmid #25999) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5’- GCCACCGATGAAGCTTATAAA -3’. ..
Article Title: Spectrin coordinates cell shape and signaling essential for epidermal differentiation
Article Snippet: 100 μl transfection mix was used per well with 1 ml FAD medium (12-well plate, 5 nM siRNA f.c.). siRNA (siPOOLs) against αII-Spectrin were obtained from siPOOLs from siTOOLs. .. Lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; #10878; Addgene plasmid), lentivirus-GFP, or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; #25999; Addgene plasmid) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). .. See also ( ; ) for generation of lentiviruses. shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5′-GCC ACC GAT GAA GCT TAT AAA-3′.
Plasmid Preparation:Article Title: Spectrin coordinates cell shape and signaling essential for epidermal differentiation.
Article Snippet: 100 μl transfection mix was used per well with 1 ml FAD medium (12- well plate, 5 nM siRNA f.c.). siRNA (siPOOLs) against αIISpectrin were obtained from siPOOLs from siTOOLs. .. Lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; #10878; Addgene plasmid), lentivirus-GFP, or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; #25999; Addgene plasmid) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website (http://portals.broadinstitute.org/gpp/ public/resources/protocols). .. See also (Beronja et al., 2010; Soffer et al., 2022) for generation of lentiviruses. shRNA sequences were obtained from GPP (https://portals.broadinstitute.org/ gpp/public/): Sptan1(0595) construct #TRCN0000090595, target sequence 5′-GCCACCGATGAAGCTTATAAA-3′.
Article Title: Spectrin coordinates cortical actomyosin organization and differentiation essential for a functional epithelial barrier
Article Snippet: .. Briefly, lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; Addgene plasmid #10878), lentivirus-GFP or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; Addgene plasmid #25999) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5’- GCCACCGATGAAGCTTATAAA -3’. ..
Article Title: Spectrin coordinates cell shape and signaling essential for epidermal differentiation
Article Snippet: 100 μl transfection mix was used per well with 1 ml FAD medium (12-well plate, 5 nM siRNA f.c.). siRNA (siPOOLs) against αII-Spectrin were obtained from siPOOLs from siTOOLs. .. Lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; #10878; Addgene plasmid), lentivirus-GFP, or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; #25999; Addgene plasmid) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). .. See also ( ; ) for generation of lentiviruses. shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5′-GCC ACC GAT GAA GCT TAT AAA-3′.
shRNA:Article Title: Spectrin coordinates cortical actomyosin organization and differentiation essential for a functional epithelial barrier
Article Snippet: .. Briefly, lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; Addgene plasmid #10878), lentivirus-GFP or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; Addgene plasmid #25999) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5’- GCCACCGATGAAGCTTATAAA -3’. ..
Construct:Article Title: Spectrin coordinates cortical actomyosin organization and differentiation essential for a functional epithelial barrier
Article Snippet: .. Briefly, lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; Addgene plasmid #10878), lentivirus-GFP or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; Addgene plasmid #25999) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5’- GCCACCGATGAAGCTTATAAA -3’. ..
Sequencing:Article Title: Spectrin coordinates cortical actomyosin organization and differentiation essential for a functional epithelial barrier
Article Snippet: .. Briefly, lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; Addgene plasmid #10878), lentivirus-GFP or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; Addgene plasmid #25999) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5’- GCCACCGATGAAGCTTATAAA -3’. ..
|