Review



lentivirus rfp  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Addgene inc lentivirus rfp
    Lentivirus Rfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 99 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentivirus+rfp/LV-GFP+(Plasmid+%2325999)/pmc12898032-213-23-35
    Average 95 stars, based on 99 article reviews
    lentivirus rfp - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    Generated:

    Article Title: Spectrin coordinates cell shape and signaling essential for epidermal differentiation.
    Article Snippet: 100 μl transfection mix was used per well with 1 ml FAD medium (12- well plate, 5 nM siRNA f.c.). siRNA (siPOOLs) against αIISpectrin were obtained from siPOOLs from siTOOLs. .. Lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; #10878; Addgene plasmid), lentivirus-GFP, or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; #25999; Addgene plasmid) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website (http://portals.broadinstitute.org/gpp/ public/resources/protocols). .. See also (Beronja et al., 2010; Soffer et al., 2022) for generation of lentiviruses. shRNA sequences were obtained from GPP (https://portals.broadinstitute.org/ gpp/public/): Sptan1(0595) construct #TRCN0000090595, target sequence 5′-GCCACCGATGAAGCTTATAAA-3′.

    Article Title: Spectrin coordinates cortical actomyosin organization and differentiation essential for a functional epithelial barrier
    Article Snippet: .. Briefly, lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; Addgene plasmid #10878), lentivirus-GFP or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; Addgene plasmid #25999) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5’- GCCACCGATGAAGCTTATAAA -3’. ..

    Article Title: Spectrin coordinates cell shape and signaling essential for epidermal differentiation
    Article Snippet: 100 μl transfection mix was used per well with 1 ml FAD medium (12-well plate, 5 nM siRNA f.c.). siRNA (siPOOLs) against αII-Spectrin were obtained from siPOOLs from siTOOLs. .. Lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; #10878; Addgene plasmid), lentivirus-GFP, or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; #25999; Addgene plasmid) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). .. See also ( ; ) for generation of lentiviruses. shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5′-GCC ACC GAT GAA GCT TAT AAA-3′.

    Cloning:

    Article Title: Spectrin coordinates cell shape and signaling essential for epidermal differentiation.
    Article Snippet: 100 μl transfection mix was used per well with 1 ml FAD medium (12- well plate, 5 nM siRNA f.c.). siRNA (siPOOLs) against αIISpectrin were obtained from siPOOLs from siTOOLs. .. Lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; #10878; Addgene plasmid), lentivirus-GFP, or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; #25999; Addgene plasmid) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website (http://portals.broadinstitute.org/gpp/ public/resources/protocols). .. See also (Beronja et al., 2010; Soffer et al., 2022) for generation of lentiviruses. shRNA sequences were obtained from GPP (https://portals.broadinstitute.org/ gpp/public/): Sptan1(0595) construct #TRCN0000090595, target sequence 5′-GCCACCGATGAAGCTTATAAA-3′.

    Article Title: Spectrin coordinates cortical actomyosin organization and differentiation essential for a functional epithelial barrier
    Article Snippet: .. Briefly, lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; Addgene plasmid #10878), lentivirus-GFP or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; Addgene plasmid #25999) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5’- GCCACCGATGAAGCTTATAAA -3’. ..

    Article Title: Spectrin coordinates cell shape and signaling essential for epidermal differentiation
    Article Snippet: 100 μl transfection mix was used per well with 1 ml FAD medium (12-well plate, 5 nM siRNA f.c.). siRNA (siPOOLs) against αII-Spectrin were obtained from siPOOLs from siTOOLs. .. Lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; #10878; Addgene plasmid), lentivirus-GFP, or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; #25999; Addgene plasmid) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). .. See also ( ; ) for generation of lentiviruses. shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5′-GCC ACC GAT GAA GCT TAT AAA-3′.

    Plasmid Preparation:

    Article Title: Spectrin coordinates cell shape and signaling essential for epidermal differentiation.
    Article Snippet: 100 μl transfection mix was used per well with 1 ml FAD medium (12- well plate, 5 nM siRNA f.c.). siRNA (siPOOLs) against αIISpectrin were obtained from siPOOLs from siTOOLs. .. Lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; #10878; Addgene plasmid), lentivirus-GFP, or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; #25999; Addgene plasmid) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website (http://portals.broadinstitute.org/gpp/ public/resources/protocols). .. See also (Beronja et al., 2010; Soffer et al., 2022) for generation of lentiviruses. shRNA sequences were obtained from GPP (https://portals.broadinstitute.org/ gpp/public/): Sptan1(0595) construct #TRCN0000090595, target sequence 5′-GCCACCGATGAAGCTTATAAA-3′.

    Article Title: Spectrin coordinates cortical actomyosin organization and differentiation essential for a functional epithelial barrier
    Article Snippet: .. Briefly, lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; Addgene plasmid #10878), lentivirus-GFP or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; Addgene plasmid #25999) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5’- GCCACCGATGAAGCTTATAAA -3’. ..

    Article Title: Spectrin coordinates cell shape and signaling essential for epidermal differentiation
    Article Snippet: 100 μl transfection mix was used per well with 1 ml FAD medium (12-well plate, 5 nM siRNA f.c.). siRNA (siPOOLs) against αII-Spectrin were obtained from siPOOLs from siTOOLs. .. Lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; #10878; Addgene plasmid), lentivirus-GFP, or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; #25999; Addgene plasmid) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). .. See also ( ; ) for generation of lentiviruses. shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5′-GCC ACC GAT GAA GCT TAT AAA-3′.

    shRNA:

    Article Title: Spectrin coordinates cortical actomyosin organization and differentiation essential for a functional epithelial barrier
    Article Snippet: .. Briefly, lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; Addgene plasmid #10878), lentivirus-GFP or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; Addgene plasmid #25999) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5’- GCCACCGATGAAGCTTATAAA -3’. ..

    Construct:

    Article Title: Spectrin coordinates cortical actomyosin organization and differentiation essential for a functional epithelial barrier
    Article Snippet: .. Briefly, lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; Addgene plasmid #10878), lentivirus-GFP or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; Addgene plasmid #25999) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5’- GCCACCGATGAAGCTTATAAA -3’. ..

    Sequencing:

    Article Title: Spectrin coordinates cortical actomyosin organization and differentiation essential for a functional epithelial barrier
    Article Snippet: .. Briefly, lentiviral plasmids were generated by cloning oligonucleotides into pLKO.1-TRC (gift from David Root, Broad Institute, Cambridge, MA, USA; Addgene plasmid #10878), lentivirus-GFP or lentivirus-RFP (gift from Elaine Fuchs, Rockefeller University, New York, NY, USA; Addgene plasmid #25999) by digestion with EcoRI and AgeI, as described in the Genetic Perturbation Platform (GPP) website ( http://portals.broadinstitute.org/gpp/public/resources/protocols ). shRNA sequences were obtained from GPP ( https://portals.broadinstitute.org/gpp/public/ ): Sptan1(0595) construct #TRCN0000090595, target sequence 5’- GCCACCGATGAAGCTTATAAA -3’. ..



    Similar Products

    95
    ATCC lentivirus encoding egfp pwptorlifeact rfp ires eb3 yfp
    Lentivirus Encoding Egfp Pwptorlifeact Rfp Ires Eb3 Yfp, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentivirus+rfp/EB-3/pm41107317-231-0-34
    Average 95 stars, based on 1 article reviews
    lentivirus encoding egfp pwptorlifeact rfp ires eb3 yfp - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    Addgene inc lentivirus rfp
    Lentivirus Rfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentivirus+rfp/LV-GFP+(Plasmid+%2325999)/pmc12898032-213-23-35
    Average 95 stars, based on 1 article reviews
    lentivirus rfp - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    86
    Genechem rfp mwasabi lc3 lentivirus
    Rfp Mwasabi Lc3 Lentivirus, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentivirus+rfp/fluorescent+gpl2001a+lc3+lentivirus+tagged+tandem/pm41792371-164-27-32
    Average 86 stars, based on 1 article reviews
    rfp mwasabi lc3 lentivirus - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    93
    Addgene inc pcw57 rfp p2a mcs dna lentivirus vector
    Pcw57 Rfp P2a Mcs Dna Lentivirus Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentivirus+rfp/pCW57-RFP-P2A-MCS+(Plasmid+%2378933)/pmc12561735-75-21-25
    Average 93 stars, based on 1 article reviews
    pcw57 rfp p2a mcs dna lentivirus vector - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    86
    Genechem rfp gfp tagged lc3 lentivirus
    A – C H23, Calu-1, and H1299 cells were exposed to ADA (5 μM) for specified durations, followed by Western blot to evaluate the expression of NRF2 and GAPDH. D – F H23, Calu-1, and H1299 cells were exposed to varying concentrations of ADA for 1 h, followed by Western blot to evaluate the expression of NRF2 and GAPDH. G H23 and H1299 cells were transfected with recombinant <t>lentivirus,</t> and the levels of NRF2 and GAPDH were subsequently measured. H H23 and H1299 cells were transfected with recombinant lentivirus. The cell survival rate was assessed after treatment with ADA (5 μM) for 24 h. I H460 cells were exposed to varying concentrations of ADA for 24 h, after which cell viability was assessed. J , K H460 cells were treated with ADA (5 μM) for specified durations, followed by Western blot to evaluate the expression of NRF2 and GAPDH. L – N H23, Calu-1, and H1299 cells were pre-incubated with DFO (100 μM) for 1 h, the cell survival rate was evaluated after treated with ADA (5 μM) for 24 h. * p < 0.05, ** p < 0.01, as determined by One-way ANOVA.
    Rfp Gfp Tagged Lc3 Lentivirus, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentivirus+rfp/adenovirus+recombinant/pmc12316882-253-1-7
    Average 86 stars, based on 1 article reviews
    rfp gfp tagged lc3 lentivirus - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    Image Search Results


    A – C H23, Calu-1, and H1299 cells were exposed to ADA (5 μM) for specified durations, followed by Western blot to evaluate the expression of NRF2 and GAPDH. D – F H23, Calu-1, and H1299 cells were exposed to varying concentrations of ADA for 1 h, followed by Western blot to evaluate the expression of NRF2 and GAPDH. G H23 and H1299 cells were transfected with recombinant lentivirus, and the levels of NRF2 and GAPDH were subsequently measured. H H23 and H1299 cells were transfected with recombinant lentivirus. The cell survival rate was assessed after treatment with ADA (5 μM) for 24 h. I H460 cells were exposed to varying concentrations of ADA for 24 h, after which cell viability was assessed. J , K H460 cells were treated with ADA (5 μM) for specified durations, followed by Western blot to evaluate the expression of NRF2 and GAPDH. L – N H23, Calu-1, and H1299 cells were pre-incubated with DFO (100 μM) for 1 h, the cell survival rate was evaluated after treated with ADA (5 μM) for 24 h. * p < 0.05, ** p < 0.01, as determined by One-way ANOVA.

    Journal: Cell Death Discovery

    Article Title: Panobinostat potentiates adagrasib-induced cell death by triggering autophagy in human non-small cell lung cancer

    doi: 10.1038/s41420-025-02657-9

    Figure Lengend Snippet: A – C H23, Calu-1, and H1299 cells were exposed to ADA (5 μM) for specified durations, followed by Western blot to evaluate the expression of NRF2 and GAPDH. D – F H23, Calu-1, and H1299 cells were exposed to varying concentrations of ADA for 1 h, followed by Western blot to evaluate the expression of NRF2 and GAPDH. G H23 and H1299 cells were transfected with recombinant lentivirus, and the levels of NRF2 and GAPDH were subsequently measured. H H23 and H1299 cells were transfected with recombinant lentivirus. The cell survival rate was assessed after treatment with ADA (5 μM) for 24 h. I H460 cells were exposed to varying concentrations of ADA for 24 h, after which cell viability was assessed. J , K H460 cells were treated with ADA (5 μM) for specified durations, followed by Western blot to evaluate the expression of NRF2 and GAPDH. L – N H23, Calu-1, and H1299 cells were pre-incubated with DFO (100 μM) for 1 h, the cell survival rate was evaluated after treated with ADA (5 μM) for 24 h. * p < 0.05, ** p < 0.01, as determined by One-way ANOVA.

    Article Snippet: The RFP-GFP-tagged LC3 lentivirus was obtained from GeneChem (Shanghai, China).

    Techniques: Western Blot, Expressing, Transfection, Recombinant, Incubation

    A – C H23, Calu-1, and H1299 cells were treated with ADA (5 μM) for specified durations, followed by Western blot to assess the expression of LC3 and GAPDH. D – F H23, Calu-1, and H1299 cells were exposed to varying concentrations of ADA for 1 h, followed by Western blot to assess the expression of LC3 and GAPDH. G , H H23 and H1299 cells were transfected with lentivirus, images were captured using a fluorescence microscope after treatment with varying concentrations of ADA for 9 h. The autophagic flux can be assessed by comparing the number of GFP (green fluorescence)/mRFP (red fluorescence) double-positive vesicles. Scale bar = 25 μm.** p < 0.01, as determined by One-way ANOVA.

    Journal: Cell Death Discovery

    Article Title: Panobinostat potentiates adagrasib-induced cell death by triggering autophagy in human non-small cell lung cancer

    doi: 10.1038/s41420-025-02657-9

    Figure Lengend Snippet: A – C H23, Calu-1, and H1299 cells were treated with ADA (5 μM) for specified durations, followed by Western blot to assess the expression of LC3 and GAPDH. D – F H23, Calu-1, and H1299 cells were exposed to varying concentrations of ADA for 1 h, followed by Western blot to assess the expression of LC3 and GAPDH. G , H H23 and H1299 cells were transfected with lentivirus, images were captured using a fluorescence microscope after treatment with varying concentrations of ADA for 9 h. The autophagic flux can be assessed by comparing the number of GFP (green fluorescence)/mRFP (red fluorescence) double-positive vesicles. Scale bar = 25 μm.** p < 0.01, as determined by One-way ANOVA.

    Article Snippet: The RFP-GFP-tagged LC3 lentivirus was obtained from GeneChem (Shanghai, China).

    Techniques: Western Blot, Expressing, Transfection, Fluorescence, Microscopy

    A – C H23, Calu-1, and H1299 cells were pre-incubated with 3-MA for 1 h, the expression levels of LC3 and GAPDH were detected after treatment with ADA (5 μM) for 1 h. D , E H23 and H1299 cells were transfected with lentivirus and then pre-incubated with 3-MA for 1 h, images were captured using a fluorescence microscope after treatment with ADA (5 μM) for 9 h. F – H H23, Calu-1 and H1299 cells were pre-incubated with 3-MA for 1 h, the cell survival rate was detected after treatment with ADA (5 μM) for 24 h. I H1299 cells were pre-incubated with NAC for 1 h, the expression levels of LC3 and GAPDH were detected after treatment with ADA (5 μM) for 1 h. J H1299 cells were transfected with lentivirus and then pre-incubated with NAC for 1 h, images were captured using a fluorescence microscope after treatment with ADA (5 μM) for 9 h. Scale bar = 25 μm. * p < 0.05, ** p < 0.01, as determined by One-way ANOVA.

    Journal: Cell Death Discovery

    Article Title: Panobinostat potentiates adagrasib-induced cell death by triggering autophagy in human non-small cell lung cancer

    doi: 10.1038/s41420-025-02657-9

    Figure Lengend Snippet: A – C H23, Calu-1, and H1299 cells were pre-incubated with 3-MA for 1 h, the expression levels of LC3 and GAPDH were detected after treatment with ADA (5 μM) for 1 h. D , E H23 and H1299 cells were transfected with lentivirus and then pre-incubated with 3-MA for 1 h, images were captured using a fluorescence microscope after treatment with ADA (5 μM) for 9 h. F – H H23, Calu-1 and H1299 cells were pre-incubated with 3-MA for 1 h, the cell survival rate was detected after treatment with ADA (5 μM) for 24 h. I H1299 cells were pre-incubated with NAC for 1 h, the expression levels of LC3 and GAPDH were detected after treatment with ADA (5 μM) for 1 h. J H1299 cells were transfected with lentivirus and then pre-incubated with NAC for 1 h, images were captured using a fluorescence microscope after treatment with ADA (5 μM) for 9 h. Scale bar = 25 μm. * p < 0.05, ** p < 0.01, as determined by One-way ANOVA.

    Article Snippet: The RFP-GFP-tagged LC3 lentivirus was obtained from GeneChem (Shanghai, China).

    Techniques: Incubation, Expressing, Transfection, Fluorescence, Microscopy

    A H23 cells were treated with ADA (0.3125 μM) alone or in combination with BRU (10 nM), PAN (20 nM) and VOR (0.5 μM) for 24 h, after which cell viability was assessed. B – E H23 and H1299 cells were treated with PAN alone or in combination with various concentrations of ADA (20, 40, 80, 160, 320 nM) for 24 h, after which cell viability and related CI values were assessed. F – H H23 and H1299 cells were treated with ADA or PAN alone, or in combination for 3 h, the associated proteins were detected by Western blot. I H1299 cells were treated with ADA or PAN alone, or in combination for 9 h, the associated proteins were detected by Western blot. J , K H23 and H1299 cells were transfected with lentivirus, images were captured using a fluorescence microscope after treated with ADA or PAN alone, or in combination for 9 h. Scale bar = 25 μm. ** p < 0.01, as determined by Two-way ANOVA.

    Journal: Cell Death Discovery

    Article Title: Panobinostat potentiates adagrasib-induced cell death by triggering autophagy in human non-small cell lung cancer

    doi: 10.1038/s41420-025-02657-9

    Figure Lengend Snippet: A H23 cells were treated with ADA (0.3125 μM) alone or in combination with BRU (10 nM), PAN (20 nM) and VOR (0.5 μM) for 24 h, after which cell viability was assessed. B – E H23 and H1299 cells were treated with PAN alone or in combination with various concentrations of ADA (20, 40, 80, 160, 320 nM) for 24 h, after which cell viability and related CI values were assessed. F – H H23 and H1299 cells were treated with ADA or PAN alone, or in combination for 3 h, the associated proteins were detected by Western blot. I H1299 cells were treated with ADA or PAN alone, or in combination for 9 h, the associated proteins were detected by Western blot. J , K H23 and H1299 cells were transfected with lentivirus, images were captured using a fluorescence microscope after treated with ADA or PAN alone, or in combination for 9 h. Scale bar = 25 μm. ** p < 0.01, as determined by Two-way ANOVA.

    Article Snippet: The RFP-GFP-tagged LC3 lentivirus was obtained from GeneChem (Shanghai, China).

    Techniques: Western Blot, Transfection, Fluorescence, Microscopy

    A H23 cells were pre-incubated with 3-MA for 1 h, the expression of LC3 and GAPDH was detected by Western blot after treated with a combination of ADA (80 nM) and PAN (20 nM) for 9 h. B , C H23 and H1299 cells were pre-incubated with 3-MA for 1 h, the cell survival rate was evaluated after treatment with ADA (80 nM for H23 cells, 160 nM for H1299 cells) and PAN (20 nM for H23 cells, 100 nM for H1299 cells) for 24 h. D , E H23 and H1299 cells were transfected with lentivirus and then pre-incubated with 3-MA for 1 h, images were captured using a fluorescence microscope after treatment with ADA (80 nM for H23 cells, 160 nM for H1299 cells) and PAN (20 nM for H23 cells, 100 nM for H1299 cells) for 9 h. F H23 cells were pre-incubated with NAC for 1 h, the expression levels of LC3 and GAPDH were detected by Western blot after treatment with ADA (80 nM) and PAN (20 nM) for 9 h. G , H H23 and H1299 cells were pre-incubated with NAC for 1 h, the cell survival rate was assessed after treatment with ADA (80 nM for H23 cells, 160 nM for H1299 cells) and PAN (20 nM for H23 cells, 100 nM for H1299 cells) for 24 h. I , J H23 and H1299 cells were transfected with lentivirus and then pre-incubated with NAC for 1 h, images were captured using a fluorescence microscope after treatment with ADA (80 nM for H23 cells, 160 nM for H1299 cells) and PAN (20 nM for H23 cells, 100 nM for H1299 cells) for 9 h. Scale bar = 25 μm. * p < 0.05, ** p < 0.01, as determined by One-way ANOVA.

    Journal: Cell Death Discovery

    Article Title: Panobinostat potentiates adagrasib-induced cell death by triggering autophagy in human non-small cell lung cancer

    doi: 10.1038/s41420-025-02657-9

    Figure Lengend Snippet: A H23 cells were pre-incubated with 3-MA for 1 h, the expression of LC3 and GAPDH was detected by Western blot after treated with a combination of ADA (80 nM) and PAN (20 nM) for 9 h. B , C H23 and H1299 cells were pre-incubated with 3-MA for 1 h, the cell survival rate was evaluated after treatment with ADA (80 nM for H23 cells, 160 nM for H1299 cells) and PAN (20 nM for H23 cells, 100 nM for H1299 cells) for 24 h. D , E H23 and H1299 cells were transfected with lentivirus and then pre-incubated with 3-MA for 1 h, images were captured using a fluorescence microscope after treatment with ADA (80 nM for H23 cells, 160 nM for H1299 cells) and PAN (20 nM for H23 cells, 100 nM for H1299 cells) for 9 h. F H23 cells were pre-incubated with NAC for 1 h, the expression levels of LC3 and GAPDH were detected by Western blot after treatment with ADA (80 nM) and PAN (20 nM) for 9 h. G , H H23 and H1299 cells were pre-incubated with NAC for 1 h, the cell survival rate was assessed after treatment with ADA (80 nM for H23 cells, 160 nM for H1299 cells) and PAN (20 nM for H23 cells, 100 nM for H1299 cells) for 24 h. I , J H23 and H1299 cells were transfected with lentivirus and then pre-incubated with NAC for 1 h, images were captured using a fluorescence microscope after treatment with ADA (80 nM for H23 cells, 160 nM for H1299 cells) and PAN (20 nM for H23 cells, 100 nM for H1299 cells) for 9 h. Scale bar = 25 μm. * p < 0.05, ** p < 0.01, as determined by One-way ANOVA.

    Article Snippet: The RFP-GFP-tagged LC3 lentivirus was obtained from GeneChem (Shanghai, China).

    Techniques: Incubation, Expressing, Western Blot, Transfection, Fluorescence, Microscopy

    A H1299 cells were subcutaneously injected into nude mice, and tumor volumes were measured in the vehicle, ADA, PAN, and combined ADA and PAN treatment groups. B An image of tumors for different groups was captured. C The weights of tumors for different groups were measured. D The body weights of nude mice in different groups were measured. E HE staining was performed on liver and kidney tissues in different groups. F Ki67 levels in the tumors were measured in different groups. G – K The expression of NRF2, LC3, p-ERK, ERK and GAPDH was evaluated by Western blot. ** p < 0.01, as determined by One-way ANOVA.

    Journal: Cell Death Discovery

    Article Title: Panobinostat potentiates adagrasib-induced cell death by triggering autophagy in human non-small cell lung cancer

    doi: 10.1038/s41420-025-02657-9

    Figure Lengend Snippet: A H1299 cells were subcutaneously injected into nude mice, and tumor volumes were measured in the vehicle, ADA, PAN, and combined ADA and PAN treatment groups. B An image of tumors for different groups was captured. C The weights of tumors for different groups were measured. D The body weights of nude mice in different groups were measured. E HE staining was performed on liver and kidney tissues in different groups. F Ki67 levels in the tumors were measured in different groups. G – K The expression of NRF2, LC3, p-ERK, ERK and GAPDH was evaluated by Western blot. ** p < 0.01, as determined by One-way ANOVA.

    Article Snippet: The RFP-GFP-tagged LC3 lentivirus was obtained from GeneChem (Shanghai, China).

    Techniques: Injection, Staining, Expressing, Western Blot